| Bioinformatics Toolbox | |
Count dimers in a sequence
Dimers = dimercount(SeqNT,
'PropertyName', PropertyValue...)
[Dimers, Percent] = dimercount(SeqNT)
dimercount(..., 'Chart', ChartStyle)
SeqNT | Nucleotide sequence. Enter a character string or vector of integers. Examples: 'ACGT' and [1 2 3 4].You can also enter a structure with the field Sequence. |
ChartStyle | Property to select the type of plot. Enter 'pie' or 'bar'. |
Dimers = dimercount(SeqNT, 'PropertyName', PropertyValue...) counts the number of nucleotide dimers in a 1-by-1 sequence and returns the dimer counts in a structure with the fields AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, TT.
For sequences that have dimers with the character U, the U characters are added to dimers with T characters.
If the sequence contains ambiguous nucleotide characters (R Y K M S W B D H V N) , or gaps indicated with a hyphen (-), this function creates a field Others and displays a warning message.
Warning: Ambiguous symbols 'symbol list' appear in the sequence.
These will be in Others.
If the sequence contains undefined nucleotide characters (E F H I J L O P Q X Z), codoncount ignores the characters and displays a warning message.
Warning: Unknown symbols 'symbol list' appear in the sequence.
These will be ignored.[Dimers, Percent] = dimercount(SeqNT) returns a 4-by-4 matrix with the relative proportions of the dimers in SeqNT. The rows correspond to A, C, G, and T in the first element of the dimer, and the columns correspond to A, C, G, and T in the second element.
dimercount(..., 'Chart', ChartStyle) creates a chart showing the relative proportions of the dimers. Valid styles are 'Pie' and 'Bar'.
Count the number of dimers in a nucleotide sequence.
dimercount('TAGCTGGCCAAGCGAGCTTG')
ans =
AA: 1
AC: 0
AG: 3
AT: 0
CA: 1
CC: 1
CG: 1
CT: 2
GA: 1
GC: 4
GG: 1
GT: 0
TA: 1
TC: 0
TG: 2
TT: 1
Bioinformatics Toolbox functions aacount, basecount, baselookup, codoncount, nmercount
| | dayhoff | dna2rna | |
© 1994-2005 The MathWorks, Inc.