| Bioinformatics Toolbox | ![]() |
Generate random sequence from finite alphabet
Seq = randseq(Length, 'PropertyName', PropertyValue) randseq(..., 'Alphabet', AlphabetValue) randseq(..., 'Weights', WeightsValue) randseq(..., 'FromStructure', FromStructureValue) randseq(..., 'Case',CaseValue) randseq(..., 'DataType', DataTypeValue)
Length | |
AlphabetValue | Property to select the alphabet for the sequence. Enter 'dna', 'rna', or 'amino'. The default value is 'dna'. |
WeightsValue | Property to specify a weighted random sequence. |
| FromStructureValue | Property to specify a weighted random sequence using output structures from the functions basecount, dimercount, codoncount, or aacount. |
CaseValue | Property to select the case of letters in a sequence when Alphabet is 'char'. Values are'upper' or 'lower'. The default value is 'upper'. |
DataTypeValue | Property to select the data type for a sequence. Values are 'char' for letter sequences, and 'uint8' or 'double' for numeric sequences. Creates a sequence as an array of DataType. The default data type is 'char'. |
randseq(...,'Alphabet', AlphabetValue) generates a sequence from a specific alphabet.
randseq(..., 'Weights', WeightsValue) creates a weighted random sequence where the ith letter of the sequence alphabet is selected with weight W(i). The weight vector is usually a probability vector or a frequency count vector. Note that the ith element of the nucleotide alphabet is given by int2nt(i), and the ith element of the amino acid alphabet is given by int2aa(i).
randseq(..., 'FromStructure', FromStructureValue) creates a weighted random sequence with weights given by the output structure from basecount, dimercount, codoncount, or aacount.
randseq(..., 'Case', CaseValue) specifies the case for a letter sequence.
randseq(...,'DataType', DataTypeValue) specifies the data type for the sequence array.
Generate a random DNA sequence.
randseq(20) ans = TAGCTGGCCAAGCGAGCTTG
Generate a random RNA sequence.
randseq(20,'alphabet','rna') ans = GCUGCGGCGGUUGUAUCCUG
Generate a random protein sequence.
randseq(20,'alphabet','amino') ans = DYKMCLYEFGMFGHFTGHKK
MATLAB functions rand, randperm, permute, datatypes
| ramachandran | redgreencmap | ![]() |
© 1994-2005 The MathWorks, Inc.