Bioinformatics ToolboxPrevious page   Next page

restrict

Split nucleotide sequence at specified restriction site

Syntax 

restrict(SeqNT, Enzyme, 'PropertyName', PropertyValue)
restrict(SeqNT, Pattern, Position)

restrict(..., 'PartialDigest', PartialDigestValue)

Arguments

SeqNT

Nucleotide sequence. Enter either a character string with the characters A, T, G, C, and ambiguous characters R, Y, K, M, S, W, B, D, H, V, N, or a vector of integers. You can also enter a structure with the field Sequence.

Enzyme

Enter the name of a restriction enzyme from REBASE.

Pattern

Enter a short nucleotide pattern. Pattern can be a regular expression.

Position

Defines the position on Pattern where the sequence is cut. Position=0 corresponds to the 5' end of the Pattern.

PartialDigestValue

Property to specify a probability for partial digestion. Enter a value from 0 to 1.

Description

restrict(SeqNT, Enzyme) cuts a sequence at restriction sites defined by a restriction enzyme in REBASE. The return values are stored in a cell array of sequences.

REBASE, the restriction enzyme database, is a collection of information about restriction enzymes and related proteins. Search REBASE for the name of a restriction enzyme at 

http://rebase.neb.com/rebase/rebase.html

For more information on REBASE, go to

http://rebase.neb.com/rebase/rebase.html

restrict(SeqNT, Pattern, Position) cuts a sequence at restriction sites specified by a nucleotide pattern.

restrict(..., 'PartialDigest', PartialDigestValue) simulates a partial digest where each restriction site in the sequence has a probability PartilDigest of being cut.

Examples

Use the recognition pattern (sequence) GCGC with the point of cleavage at position 3 to cleave a nucleotide sequence.

Seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA';
partsP = restrict(Seq,'GCGC',3);


partsP = 
    'AGAGGGGTACGCG'
    'CTCTGAAAAGCGGGAACCTCGTGGCG'
    'CTTTATTAA'

Use the restriction enzyme HspAI (recognition sequence GCGC with the point of cleavage at position 1) to cleave a nucleotide sequence.

partsE = restrict(Seq,'HspAI')

partsE = 
    'AGAGGGGTACG'
    'CGCTCTGAAAAGCGGGAACCTCGTGG'
    'CGCTTTATTAA'

See Also

Bioinformatics Toolbox function seqshowwords

MATLAB function regexp

Previous page redgreencmap revgeneticcodeNext page

© 1994-2005 The MathWorks, Inc.