%% BIOJAVADEMO: Example of using BioJava from within MATLAB
% This demonstration illustrates how to create BioJava objects and call
% BioJava methods from within MATLAB. 
%
% NOTE: This example uses the BioJava binary jar files. These must be
% installed to run this demonstration. See http://www.biojava.org for
% current release files and complete installation instructions. This
% example was written using biojava-1.3.1.jar. Versions prior to 1.3.1 
% will not work.
%
% For more information on the use of specific BioJava classes, see the
% BioJava JavaDoc at http://www.biojava.org/docs/api/index.html .

%   Copyright 2003-2004 The MathWorks, Inc. 
%   $Revision: 1.1.4.3 $  $Date: 2004/12/24 20:38:15 $ 

if playbiodemo, return; end % Open in the editor or run step-by-step

%% Adding BioJava to the Java Classpath
% MATLAB can directly interact with Java classes. A new feature in MATLAB
% R14 allows you to dynamically add new Java classes to MATLAB. This is
% done using the *javaclasspath* function. 

% Modify this line to the correct location of your biojava installation.
biojavaDir = 'D:\biojava';
% If you have the full installation of BioJava, you only need to specify
% the path to the jar file.
biojavaJar = 'biojava-1.3.1.jar';
jarPath = fullfile(biojavaDir,biojavaJar);

% Add BioJava to the dynamic Java path.
javaclasspath(jarPath);

%% Importing Java classes
% You will next need to import the BioJava classes that you want to use.

import org.biojava.bio.symbol.*;
import org.biojava.bio.seq.*;

%% Creating a sequence object
% Create a DNA Symbolic List object.
seq = 'tagcttcatcgttgacttctactaaaagcaactgtgagtaa';
dna = DNATools.createDNA(seq);
% Note that this is a Java object, not a MATLAB character array.
JavaObject = class(dna)
% To retrieve the sequence as a MATLAB character array, use the seqString
% method.
seqFromObject = dna.seqString

%% Manipulating the sequence 
% You can use the DNATools methods to manipulate sequence. In this example
% the reverse complement of the sequence is calculated and the DNA sequence
% is transcribed to an RNA sequence. 

rdna = DNATools.reverseComplement(dna);
rdnaseq = rdna.seqString
rna = RNATools.transcribe(dna);
rnaseq = rna.seqString

%% Displaying the sequence in a figure window
% BioJava includes several graphics functions including a trace viewer and
% GUIs for displaying sequences. These are in the gui.sequence package.
% After importing the package, you can create a SequencePanel object that
% will be used to display the sequence. 

import org.biojava.bio.gui.sequence.*;
seqPanel = SequencePanel;
% Set the sequence to be displayed.
seqPanel.setSequence(rna);
% Set the range of the sequence to be shown.
seqPanel.setRange(RangeLocation(1,rna.length()));

%% 
% BioJava provides many different ways to visualize a sequence. By using a
% MultiLineRenderer object you can use several of these methods at once.

mlr = MultiLineRenderer;
% A SymbolSequenceRenderer is used to display the symbols a,c,g,t.
mlr.addRenderer(SymbolSequenceRenderer);
% A RulerRenderer is used to display a ruler showing positions along the
% sequence.
mlr.addRenderer(RulerRenderer);
seqPanel.setRenderer(mlr);

%% 
% Create a figure and add the sequence panel to the figure using the
% *javacomponent* function

F = figure;
javacomponent(seqPanel, java.awt.BorderLayout.NORTH, F);

% Try resizing the figure. The seqPanel object will report back to the
% MATLAB Command Window on how much of the sequence is visible.